A lot of very knowledgable people today are engaged in a heated, oftentimes uncivil debate about the sensitive issue of abortion. Since I have little or no intellectual capacity to add to that multi-dimensional debate, I will simply play my jilpa card and generally join in this melee.
Since I have limited knowledge about the debate in today’s context, I will attempt to escape to the future and ask some questions.
Apparently, the Culture of Life people believe that life starts at conception. So a single cell, the embryo is worth saving because it technically has the potential to become a fully grown human being. If I remember from what I learnt in school, every cell in the human body “technically” has the ability to recreate an entire human being (through Cloning). The DNA sequence in every cell of our body is exactly the same. That is every individual’s genetic blueprint. So 200 years from now, will the anti-abortionists fight to save every human cell? Sneezing will then have to be outlawed. Haircutting as well.
Lets take this farcicial argument a few more years into the future. Say 500 years. Let us then assume that scientists can create DNA sequences in the laboratory using off-the-shelf chemicals and designer enzymes. This is not actually that far fetched. I wouldnt be surprised if we can do this in much lesser than 500 years from now. So scientists create a designer human genome in the laboratory and splice it into an existing sperm cell. So now, the anti-abortion argument should (if they care even a little bit about life) embrace the absolute need to ban the “Cut” and “delete” functions on everybody’s computer. Dont get it? Here’s why:
GCATAAATGCGAAGTCGGCGCCCTAAATCCCCTTCCTAAA (and so on) = Gene sequence for tendency to be moronically religious.
If anybody could cruelly and immorally “cut” or “delete” the text above, it’s a crime against humanity. We just prevented a religious nut from being born. And that…as far the anti-abortionists are concerned, could be a serious problem from them in the future. The accelerated Darwinian weeding out of religious nuts.
Technorati Tags: abortion rights, Religious Nuts
Doing Jalsa & Showing Jilpa 
Leave a Reply