Culture of Life

Written in

by

A lot of very knowledgable people today are engaged in a heated, oftentimes uncivil debate about the sensitive issue of abortion. Since I have little or no intellectual capacity to add to that multi-dimensional debate, I will simply play my jilpa card and generally join in this melee.

Since I have limited knowledge about the debate in today’s context, I will attempt to escape to the future and ask some questions.

Apparently, the Culture of Life people believe that life starts at conception. So a single cell, the embryo is worth saving because it technically has the potential to become a fully grown human being. If I remember from what I learnt in school, every cell in the human body “technically” has the ability to recreate an entire human being (through Cloning). The DNA sequence in every cell of our body is exactly the same. That is every individual’s genetic blueprint. So 200 years from now, will the anti-abortionists fight to save every human cell? Sneezing will then have to be outlawed. Haircutting as well.

Lets take this farcicial argument a few more years into the future. Say 500 years. Let us then assume that scientists can create DNA sequences in the laboratory using off-the-shelf chemicals and designer enzymes. This is not actually that far fetched. I wouldnt be surprised if we can do this in much lesser than 500 years from now. So scientists create a designer human genome in the laboratory and splice it into an existing sperm cell. So now, the anti-abortion argument should (if they care even a little bit about life) embrace the absolute need to ban the “Cut” and “delete” functions on everybody’s computer. Dont get it? Here’s why:

GCATAAATGCGAAGTCGGCGCCCTAAATCCCCTTCCTAAA (and so on) = Gene sequence for tendency to be moronically religious.

If anybody could cruelly and immorally “cut” or “delete” the text above, it’s a crime against humanity. We just prevented a religious nut from being born. And that…as far the anti-abortionists are concerned, could be a serious problem from them in the future. The accelerated Darwinian weeding out of religious nuts.

icon-utag-16×13.png Technorati Tags: ,

Tags

11 responses to “Culture of Life”

  1. Marc Avatar

    Or you could be in India and have abortion governed by the whims of religious fundamentalists and their incorrect and often retarded interpretation of the scriptures.

  2. Ashok Avatar

    India? Its actually easier in India. The bulk of this debate is centred around the US

  3. Karthik Krish Avatar
    Karthik Krish

    How about not eating meat then ? Thats killing living cells too.

    Karthik

  4. krishashok Avatar

    Ah. No. “Human” cells are at the crux of this issue

  5. Karthik Krish Avatar
    Karthik Krish

    http://en.wikipedia.org/wiki/Animal_cell

    A human cell is not very different from a animal cell. Both contain pretty much the same stuff except maybe the genetic differences.

  6. Karthik Krish Avatar
    Karthik Krish

    And why give special treatment to “Human Cells”?

  7. Krish Ashok Avatar

    Dont ask me. Ask the religious nutcases

  8. Marc Avatar

    It’s only easy in India because you can get away with anything.

    Plant cells are alive too, btw.

  9. mahendrap Avatar

    You present a nightmarish scenario of what will happen if the Conservative viewpoint is taken to the extreme. The fearful fact is that your nightmarish scenario may well become the truth in the future!

    If you assume that presenting this nightmare will expose the ridiculousness of their argument, wait for the next 500 (or less) years, and you’ll be shocked when nobody thinks it as nightmarish.

  10. krishashok Avatar

    Very true. So far, historical mindshifts have worked both ways – from “normal in the past” to “unacceptable in the present” (like Slavery) and “scandalous in the past” to “normal in the present” (like working women”)
    It will be hard to predict which way today’s notions of genetic engg will go.

  11. pinastro Avatar

    have some thoughts on vegetarianism too………
    Even plants are living organisms …

    Vegetarianism is definitely good ..but…not because of religious reasons or humanity reasons as told by our Munorgal …it could be bacause of the concept of “Biological concentration” is more in animals (at the top of the food chain ..when compared to the plants which are at the bottom of the chain

Leave a reply to krishashok Cancel reply

This site uses Akismet to reduce spam. Learn how your comment data is processed.